Review



p53 prk5 vectors  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc p53 prk5 vectors
    P53 Prk5 Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prk5+flag+vector/Flag-p53%2FpRK5+(Plasmid+%2339237)/pm40409543-252-41-43
    Average 93 stars, based on 6 article reviews
    p53 prk5 vectors - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Mutagenesis:

    Article Title: Defective Myofibroblast Formation from Mesenchymal Stem Cells in the Aging Murine Heart
    Article Snippet: .. The constitutively active mutant of TβRI (T202D) in the pRK5-flag vector was created by Feng and Derynck 24 and obtained from Addgene, Inc. (Cambridge, MA). pRK5-flag was used as a control vector. .. Fibroblast cultures were transfected using Fibroblast Transfection Reagent (Altogen Biosystems, Las Vegas, NV) according to the manufacturer's protocol.

    Control:

    Article Title: Defective Myofibroblast Formation from Mesenchymal Stem Cells in the Aging Murine Heart
    Article Snippet: .. The constitutively active mutant of TβRI (T202D) in the pRK5-flag vector was created by Feng and Derynck 24 and obtained from Addgene, Inc. (Cambridge, MA). pRK5-flag was used as a control vector. .. Fibroblast cultures were transfected using Fibroblast Transfection Reagent (Altogen Biosystems, Las Vegas, NV) according to the manufacturer's protocol.

    Plasmid Preparation:

    Article Title: Defective Myofibroblast Formation from Mesenchymal Stem Cells in the Aging Murine Heart
    Article Snippet: .. The constitutively active mutant of TβRI (T202D) in the pRK5-flag vector was created by Feng and Derynck 24 and obtained from Addgene, Inc. (Cambridge, MA). pRK5-flag was used as a control vector. .. Fibroblast cultures were transfected using Fibroblast Transfection Reagent (Altogen Biosystems, Las Vegas, NV) according to the manufacturer's protocol.

    Article Title: Salmonella flagella confer anti-tumor immunological effect via activating Flagellin/TLR5 signalling within tumor microenvironment
    Article Snippet: Immunohistochemistry staining was performed with CD45 antibody (ab10558, Abcam) according to standard histological procedures. .. Full length mouse Tlr5 gene was cloned (primer TLR5-1: GATGGCATGTCAACTTGACTTGC; TLR5-2: TATGCGGCCGCCTAGGAAATGGTTGCTATGG) from B16F10 melanoma cell and ligated into modified pRK5-Flag vector (Addgene). .. The mouse dominant-negative (DN) plasmids were generated with pRK5-Flag vector by amplifying the sequence as following: myeloid differentiation factor 88 DN ( Myd88 -DN) (Δ1-435, with primers MyD-1: ATTGGATCCGGCATCACCACCCTTGATGACC, MyD-2: TATCTCGAGTCAGGGCAGGGACAAAGCCTTGG), TNF receptor associated factor 6 DN ( Traf6 -DN) (Δ1-864, with primers TRAF-1: ATTGGATCCGCCGCCTCTCCATCCCGGGGAT, TRAF-2: CTCCTCGAGTCACTGGAAACCCTCCTTCCGAA), Tlr5 leucine-rich repeat domain DN (LRR-DN) (Δ907-1707, with primers LRR-1: GATGGCATGTCAACTTGACTTGC; LRR-2: AAAACACGAAGCGAAGAGAAGATAAAGCCGTGCG; LRR-3: CGCACGGCTTTATCTTCTCTTCGCTTCGTGTTTT; LRR-4: GGCAAGCTTTCAGGAAATGGTTGCTATGGTT) and Tlr5 Toll/Interleukin-1 receptor domain DN (TIR-DN) (Δ2041-2575, with primers TIR-1: GATGGCATGTCAACTTGACTTGC; TIR-2: TTAGCGGCCGCTCAGTCCTTGAACACCAGCTTC).

    Clone Assay:

    Article Title: Salmonella flagella confer anti-tumor immunological effect via activating Flagellin/TLR5 signalling within tumor microenvironment
    Article Snippet: Immunohistochemistry staining was performed with CD45 antibody (ab10558, Abcam) according to standard histological procedures. .. Full length mouse Tlr5 gene was cloned (primer TLR5-1: GATGGCATGTCAACTTGACTTGC; TLR5-2: TATGCGGCCGCCTAGGAAATGGTTGCTATGG) from B16F10 melanoma cell and ligated into modified pRK5-Flag vector (Addgene). .. The mouse dominant-negative (DN) plasmids were generated with pRK5-Flag vector by amplifying the sequence as following: myeloid differentiation factor 88 DN ( Myd88 -DN) (Δ1-435, with primers MyD-1: ATTGGATCCGGCATCACCACCCTTGATGACC, MyD-2: TATCTCGAGTCAGGGCAGGGACAAAGCCTTGG), TNF receptor associated factor 6 DN ( Traf6 -DN) (Δ1-864, with primers TRAF-1: ATTGGATCCGCCGCCTCTCCATCCCGGGGAT, TRAF-2: CTCCTCGAGTCACTGGAAACCCTCCTTCCGAA), Tlr5 leucine-rich repeat domain DN (LRR-DN) (Δ907-1707, with primers LRR-1: GATGGCATGTCAACTTGACTTGC; LRR-2: AAAACACGAAGCGAAGAGAAGATAAAGCCGTGCG; LRR-3: CGCACGGCTTTATCTTCTCTTCGCTTCGTGTTTT; LRR-4: GGCAAGCTTTCAGGAAATGGTTGCTATGGTT) and Tlr5 Toll/Interleukin-1 receptor domain DN (TIR-DN) (Δ2041-2575, with primers TIR-1: GATGGCATGTCAACTTGACTTGC; TIR-2: TTAGCGGCCGCTCAGTCCTTGAACACCAGCTTC).

    Modification:

    Article Title: Salmonella flagella confer anti-tumor immunological effect via activating Flagellin/TLR5 signalling within tumor microenvironment
    Article Snippet: Immunohistochemistry staining was performed with CD45 antibody (ab10558, Abcam) according to standard histological procedures. .. Full length mouse Tlr5 gene was cloned (primer TLR5-1: GATGGCATGTCAACTTGACTTGC; TLR5-2: TATGCGGCCGCCTAGGAAATGGTTGCTATGG) from B16F10 melanoma cell and ligated into modified pRK5-Flag vector (Addgene). .. The mouse dominant-negative (DN) plasmids were generated with pRK5-Flag vector by amplifying the sequence as following: myeloid differentiation factor 88 DN ( Myd88 -DN) (Δ1-435, with primers MyD-1: ATTGGATCCGGCATCACCACCCTTGATGACC, MyD-2: TATCTCGAGTCAGGGCAGGGACAAAGCCTTGG), TNF receptor associated factor 6 DN ( Traf6 -DN) (Δ1-864, with primers TRAF-1: ATTGGATCCGCCGCCTCTCCATCCCGGGGAT, TRAF-2: CTCCTCGAGTCACTGGAAACCCTCCTTCCGAA), Tlr5 leucine-rich repeat domain DN (LRR-DN) (Δ907-1707, with primers LRR-1: GATGGCATGTCAACTTGACTTGC; LRR-2: AAAACACGAAGCGAAGAGAAGATAAAGCCGTGCG; LRR-3: CGCACGGCTTTATCTTCTCTTCGCTTCGTGTTTT; LRR-4: GGCAAGCTTTCAGGAAATGGTTGCTATGGTT) and Tlr5 Toll/Interleukin-1 receptor domain DN (TIR-DN) (Δ2041-2575, with primers TIR-1: GATGGCATGTCAACTTGACTTGC; TIR-2: TTAGCGGCCGCTCAGTCCTTGAACACCAGCTTC).



    Similar Products

    93
    Addgene inc p53 prk5 vectors
    P53 Prk5 Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prk5+flag+vector/Flag-p53%2FpRK5+(Plasmid+%2339237)/pm40409543-252-41-43
    Average 93 stars, based on 1 article reviews
    p53 prk5 vectors - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    92
    Addgene inc usp13 expression vector flag usp13
    Usp13 Expression Vector Flag Usp13, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prk5+flag+vector/pRK5-FLAG-USP13+(Plasmid+%2361741)/pm38250150-67-1-23
    Average 92 stars, based on 1 article reviews
    usp13 expression vector flag usp13 - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    90
    Cell Biolabs Inc prk5 vector containing n-terminal flag tag
    Prk5 Vector Containing N Terminal Flag Tag, supplied by Cell Biolabs Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prk5+flag+vector/prk5+vector+containing+n+terminal+flag+tag/pmc10644541-60-6-13
    Average 90 stars, based on 1 article reviews
    prk5 vector containing n-terminal flag tag - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    92
    Addgene inc flag malt1 prk5 vector
    Flag Malt1 Prk5 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prk5+flag+vector/Flag-MALT1-%2FpRK5+(Plasmid+%2327971)/pm37059355-61-8-10
    Average 92 stars, based on 1 article reviews
    flag malt1 prk5 vector - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    92
    Addgene inc prk5 flag smad2 expression vector
    Prk5 Flag Smad2 Expression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prk5+flag+vector/pRK5F+Smad2+(Plasmid+%2312623)/pm33676037-75-7-15
    Average 92 stars, based on 1 article reviews
    prk5 flag smad2 expression vector - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    92
    Addgene inc prk5 flag vector
    Prk5 Flag Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prk5+flag+vector/pRK5-Merlin-Flag-HA+(Plasmid+%2327103)/pmc08546927-106-20-22
    Average 92 stars, based on 1 article reviews
    prk5 flag vector - by Bioz Stars, 2026-09
    92/100 stars
      Buy from Supplier

    90
    Genentech inc prk5-flag expression vector
    MAVS contains a heavily O-GlcNAcylated serine-rich region that inhibits RLR signaling. (A) Fusion M/S analysis was conducted to identify sites of O-GlcNAcylation in MAVS. EThcD spectra of the O-glylcopeptide LPGPTGSVVSTGTSFSSSSPGLASAGAAEGK from human MAVS is as shown. The site of O-GlcNAc modification was identified as serine 249. The y, b, C, and z fragments detected are as indicated in the sequence. (B, C) MAVS O-GlcNAcylation sites and the protein structures of the wild-type and MAVS Δ249–257 mutant. (D, E) IP and Western blots were performed to compare the O-GlcNAcylation of wild-type MAVS with (D) the mutant in which the serine-rich region including the O-GlcNAcylation sites were detected and (E) the mutant with the 7S/T to alanine substitution. The <t>pRK5-flag-tagged</t> MAVS wild-type and mutant plasmids were transfected into HEK293 cells and evaluated 24 h later. WCLs were incubated with agarose-conjugated anti-FLAG antibody (M2) for 1–2 h at 4°C. (F, G) Western blot analysis of phospho-IRF3 (p-IRF3) in WCLs from HEK293 cells. The p-IRF3 levels were determined by transfection with pRK5-flag-tagged MAVS wild-type, (F) deletion mutant, or (G) substitution mutant plasmids followed by evaluation 24 h later; cells were infected with SeV (100 HAU) for 24 h followed by Western blotting. (H) Expression of IFN-β mRNA induced by overexpression of wild-type and mutant MAVS was measured by real-time qPCR. The decreased levels of IFN-β expression in response to the S366A mutant underwent full recovery in response to the Δ249–257 mutant containing S366A when compared to the wild type. n = 3. (D–H) Experiments were performed at least three times. (D–H) – indicated cells transfected with flag or myc empty vectors. Statistical significance of (H) was determined by one-way ANOVA. Results were presented as mean ± SEM; *p < 0.05, **p < 0.01.
    Prk5 Flag Expression Vector, supplied by Genentech inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prk5+flag+vector/prk5/pmc07884448-45-17-20
    Average 90 stars, based on 1 article reviews
    prk5-flag expression vector - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    93
    Addgene inc px330 vector

    Px330 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/prk5+flag+vector/pRK5-FLAG-p14+(Plasmid+%2342330)/pmc07809799-307-18-21
    Average 93 stars, based on 1 article reviews
    px330 vector - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    MAVS contains a heavily O-GlcNAcylated serine-rich region that inhibits RLR signaling. (A) Fusion M/S analysis was conducted to identify sites of O-GlcNAcylation in MAVS. EThcD spectra of the O-glylcopeptide LPGPTGSVVSTGTSFSSSSPGLASAGAAEGK from human MAVS is as shown. The site of O-GlcNAc modification was identified as serine 249. The y, b, C, and z fragments detected are as indicated in the sequence. (B, C) MAVS O-GlcNAcylation sites and the protein structures of the wild-type and MAVS Δ249–257 mutant. (D, E) IP and Western blots were performed to compare the O-GlcNAcylation of wild-type MAVS with (D) the mutant in which the serine-rich region including the O-GlcNAcylation sites were detected and (E) the mutant with the 7S/T to alanine substitution. The pRK5-flag-tagged MAVS wild-type and mutant plasmids were transfected into HEK293 cells and evaluated 24 h later. WCLs were incubated with agarose-conjugated anti-FLAG antibody (M2) for 1–2 h at 4°C. (F, G) Western blot analysis of phospho-IRF3 (p-IRF3) in WCLs from HEK293 cells. The p-IRF3 levels were determined by transfection with pRK5-flag-tagged MAVS wild-type, (F) deletion mutant, or (G) substitution mutant plasmids followed by evaluation 24 h later; cells were infected with SeV (100 HAU) for 24 h followed by Western blotting. (H) Expression of IFN-β mRNA induced by overexpression of wild-type and mutant MAVS was measured by real-time qPCR. The decreased levels of IFN-β expression in response to the S366A mutant underwent full recovery in response to the Δ249–257 mutant containing S366A when compared to the wild type. n = 3. (D–H) Experiments were performed at least three times. (D–H) – indicated cells transfected with flag or myc empty vectors. Statistical significance of (H) was determined by one-way ANOVA. Results were presented as mean ± SEM; *p < 0.05, **p < 0.01.

    Journal: Frontiers in Immunology

    Article Title: O- Linked N-Acetylglucosamine Modification of Mitochondrial Antiviral Signaling Protein Regulates Antiviral Signaling by Modulating Its Activity

    doi: 10.3389/fimmu.2020.589259

    Figure Lengend Snippet: MAVS contains a heavily O-GlcNAcylated serine-rich region that inhibits RLR signaling. (A) Fusion M/S analysis was conducted to identify sites of O-GlcNAcylation in MAVS. EThcD spectra of the O-glylcopeptide LPGPTGSVVSTGTSFSSSSPGLASAGAAEGK from human MAVS is as shown. The site of O-GlcNAc modification was identified as serine 249. The y, b, C, and z fragments detected are as indicated in the sequence. (B, C) MAVS O-GlcNAcylation sites and the protein structures of the wild-type and MAVS Δ249–257 mutant. (D, E) IP and Western blots were performed to compare the O-GlcNAcylation of wild-type MAVS with (D) the mutant in which the serine-rich region including the O-GlcNAcylation sites were detected and (E) the mutant with the 7S/T to alanine substitution. The pRK5-flag-tagged MAVS wild-type and mutant plasmids were transfected into HEK293 cells and evaluated 24 h later. WCLs were incubated with agarose-conjugated anti-FLAG antibody (M2) for 1–2 h at 4°C. (F, G) Western blot analysis of phospho-IRF3 (p-IRF3) in WCLs from HEK293 cells. The p-IRF3 levels were determined by transfection with pRK5-flag-tagged MAVS wild-type, (F) deletion mutant, or (G) substitution mutant plasmids followed by evaluation 24 h later; cells were infected with SeV (100 HAU) for 24 h followed by Western blotting. (H) Expression of IFN-β mRNA induced by overexpression of wild-type and mutant MAVS was measured by real-time qPCR. The decreased levels of IFN-β expression in response to the S366A mutant underwent full recovery in response to the Δ249–257 mutant containing S366A when compared to the wild type. n = 3. (D–H) Experiments were performed at least three times. (D–H) – indicated cells transfected with flag or myc empty vectors. Statistical significance of (H) was determined by one-way ANOVA. Results were presented as mean ± SEM; *p < 0.05, **p < 0.01.

    Article Snippet: Wild-type and mutant forms of human MAVS wild type were prepared by PCR and cloned into the pRK5-Flag expression vector (Genentech).

    Techniques: Modification, Sequencing, Mutagenesis, Western Blot, Transfection, Incubation, Infection, Expressing, Over Expression

    O-GlcNAcylation of MAVS interferes with aggregate formation and interactions with TRAF3. (A) Non-reducing SDD-PAGE analysis was conducted to determine the level of MAVS aggregation. MAVS overexpression in HEK293 cells induced aggregate formation levels with or without overexpression of OGA. (B) Knock-down of OGT in HEK293 cells was detected at 48 h after transfection with specific siRNAs; this was performed before induction of MAVS overexpression for 24 h, after which SDD-AGE analysis was performed. (C) Endogenous MAVS aggregates were detected by SDD-AGE under conditions of OGT knock-down. HEK293 cells were transfected with siOGT; 48 h later, cells were infected with SeV (100 HAU) and evaluated at 16 h after infection. MAVS aggregates were normalized to the expression level of endogenous MAVS. (D) Precipitation was performed with sWGA followed by Western blot analysis to detect the O-GlcNAcylation levels of MAVS after a longer period of time after SeV infection (100 HAU). Cells were infected with SeV for 24 h before collection. WCLs were incubated with sWGA-conjugated beads overnight at 4°C and then were eluted for Western blot analysis. (E) An SDD-AGE assay was conducted to compare the levels of aggregation of wild-type MAVS and mutants with deleted O-GlcNAcylation sites. The pRK5-flag-tagged MAVS wild-type and mutant (Δ249–257, S366A, Δ249–257 containing S366A) plasmids were used to transfect HEK293 cells and were evaluated after 24 to 48 h. (F) A co-IP assay was performed to evaluate the interactions between MAVS and TRAF3. The pRK5-flag-tagged MAVS and HA-TRAF3 expression plasmids co-overexpressed in HEK293 cells both with and without Myc-OGT overexpression. (G) A co-IP assay was performed to evaluate the interactions between wild-type or the Δ249–257 mutant MAVS and HA-TRAF3 in HEK293 cells. Expression plasmids were used to transfect cells that were evaluated at 24 to 48 h. All experiments were repeated at least three times. (A–G) – means cells transfected with flag or Myc or HA empty vectors.

    Journal: Frontiers in Immunology

    Article Title: O- Linked N-Acetylglucosamine Modification of Mitochondrial Antiviral Signaling Protein Regulates Antiviral Signaling by Modulating Its Activity

    doi: 10.3389/fimmu.2020.589259

    Figure Lengend Snippet: O-GlcNAcylation of MAVS interferes with aggregate formation and interactions with TRAF3. (A) Non-reducing SDD-PAGE analysis was conducted to determine the level of MAVS aggregation. MAVS overexpression in HEK293 cells induced aggregate formation levels with or without overexpression of OGA. (B) Knock-down of OGT in HEK293 cells was detected at 48 h after transfection with specific siRNAs; this was performed before induction of MAVS overexpression for 24 h, after which SDD-AGE analysis was performed. (C) Endogenous MAVS aggregates were detected by SDD-AGE under conditions of OGT knock-down. HEK293 cells were transfected with siOGT; 48 h later, cells were infected with SeV (100 HAU) and evaluated at 16 h after infection. MAVS aggregates were normalized to the expression level of endogenous MAVS. (D) Precipitation was performed with sWGA followed by Western blot analysis to detect the O-GlcNAcylation levels of MAVS after a longer period of time after SeV infection (100 HAU). Cells were infected with SeV for 24 h before collection. WCLs were incubated with sWGA-conjugated beads overnight at 4°C and then were eluted for Western blot analysis. (E) An SDD-AGE assay was conducted to compare the levels of aggregation of wild-type MAVS and mutants with deleted O-GlcNAcylation sites. The pRK5-flag-tagged MAVS wild-type and mutant (Δ249–257, S366A, Δ249–257 containing S366A) plasmids were used to transfect HEK293 cells and were evaluated after 24 to 48 h. (F) A co-IP assay was performed to evaluate the interactions between MAVS and TRAF3. The pRK5-flag-tagged MAVS and HA-TRAF3 expression plasmids co-overexpressed in HEK293 cells both with and without Myc-OGT overexpression. (G) A co-IP assay was performed to evaluate the interactions between wild-type or the Δ249–257 mutant MAVS and HA-TRAF3 in HEK293 cells. Expression plasmids were used to transfect cells that were evaluated at 24 to 48 h. All experiments were repeated at least three times. (A–G) – means cells transfected with flag or Myc or HA empty vectors.

    Article Snippet: Wild-type and mutant forms of human MAVS wild type were prepared by PCR and cloned into the pRK5-Flag expression vector (Genentech).

    Techniques: Over Expression, Transfection, Infection, Expressing, Western Blot, Incubation, Mutagenesis, Co-Immunoprecipitation Assay

    Journal: The EMBO Journal

    Article Title: A microtubule‐LUZP1 association around tight junction promotes epithelial cell apical constriction

    doi: 10.15252/embj.2020104712

    Figure Lengend Snippet:

    Article Snippet: To generate LUZP1 KO, ZO‐1/‐2 DKO, and E‐cadherin KO Eph4 cells, we used the CRISPR/Cas9 system with the pX330 vector (#42330; Addgene) to knockout mouse LUZP1, ZO‐1, and E‐cadherin genes.

    Techniques: Recombinant, Plasmid Preparation, Sequencing, Transfection, Protease Inhibitor, Purification, Western Blot, Blocking Assay, Software, Imaging, Modification