p53 prk5 vectors (Addgene inc)
Structured Review
P53 Prk5 Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prk5+flag+vector/Flag-p53%2FpRK5+(Plasmid+%2339237)/pm40409543-252-41-43
Average 93 stars, based on 6 article reviews
Images
Related Articles
Mutagenesis:Article Title: Defective Myofibroblast Formation from Mesenchymal Stem Cells in the Aging Murine Heart Article Snippet: .. The constitutively active mutant of TβRI (T202D) in the Control:Article Title: Defective Myofibroblast Formation from Mesenchymal Stem Cells in the Aging Murine Heart Article Snippet: .. The constitutively active mutant of TβRI (T202D) in the Plasmid Preparation:Article Title: Defective Myofibroblast Formation from Mesenchymal Stem Cells in the Aging Murine Heart Article Snippet: .. The constitutively active mutant of TβRI (T202D) in the Article Title: Salmonella flagella confer anti-tumor immunological effect via activating Flagellin/TLR5 signalling within tumor microenvironment Article Snippet: Immunohistochemistry staining was performed with CD45 antibody (ab10558, Abcam) according to standard histological procedures. .. Full length mouse Tlr5 gene was cloned (primer TLR5-1: GATGGCATGTCAACTTGACTTGC; TLR5-2: TATGCGGCCGCCTAGGAAATGGTTGCTATGG) from B16F10 melanoma cell and ligated into modified Clone Assay:Article Title: Salmonella flagella confer anti-tumor immunological effect via activating Flagellin/TLR5 signalling within tumor microenvironment Article Snippet: Immunohistochemistry staining was performed with CD45 antibody (ab10558, Abcam) according to standard histological procedures. .. Full length mouse Tlr5 gene was cloned (primer TLR5-1: GATGGCATGTCAACTTGACTTGC; TLR5-2: TATGCGGCCGCCTAGGAAATGGTTGCTATGG) from B16F10 melanoma cell and ligated into modified Modification:Article Title: Salmonella flagella confer anti-tumor immunological effect via activating Flagellin/TLR5 signalling within tumor microenvironment Article Snippet: Immunohistochemistry staining was performed with CD45 antibody (ab10558, Abcam) according to standard histological procedures. .. Full length mouse Tlr5 gene was cloned (primer TLR5-1: GATGGCATGTCAACTTGACTTGC; TLR5-2: TATGCGGCCGCCTAGGAAATGGTTGCTATGG) from B16F10 melanoma cell and ligated into modified |

